circad | circRNAs associated with diseases

CircularRNA_104670
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Intervertebral Disc Degeneration	ICD-10	Other specified intervertebral disc degeneration (M51.3)
DBLink		PMID	30089772
Experimental Method
Sample Type	Tissue and cell lines	Comparison	20 samples (ten samples from normal and IDD subjects)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GATGATCCTCTTCTCCAGCCAC Reverse TGAAAGTAACCACAGCAACCAA	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Song, J, Wang, HL, Song, KH, Ding, ZW, Wang, HL, Ma, XS, Lu, FZ, Xia, XL, Wang, YW, Fei-Zou, JY, Jiang, (2018). CircularRNA_104670 plays a critical role in intervertebral disc degeneration by functioning as a ceRNA. Exp. Mol. Med., 50, 8:94.